1.Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA)into the 6 possible amino acid sequences (that means the 3 frame shift sequences of the original and the 3-frame shift sequences of the reverse complement). Submit your code as well as the amino acid sequences.2. Use a Perl Script to compare the query sequence to each of the subject sequences in this alignment below to identify which subject sequence has the highest sum of BLOSUM62 comparison score? ( another question (exactly like this one.))




Why Choose Us

  • 100% non-plagiarized Papers
  • 24/7 /365 Service Available
  • Affordable Prices
  • Any Paper, Urgency, and Subject
  • Will complete your papers in 6 hours
  • On-time Delivery
  • Money-back and Privacy guarantees
  • Unlimited Amendments upon request
  • Satisfaction guarantee

How it Works

  • Click on the “Place Order” tab at the top menu or “Order Now” icon at the bottom and a new page will appear with an order form to be filled.
  • Fill in your paper’s requirements in the "PAPER DETAILS" section.
  • Fill in your paper’s academic level, deadline, and the required number of pages from the drop-down menus.
  • Click “CREATE ACCOUNT & SIGN IN” to enter your registration details and get an account with us for record-keeping and then, click on “PROCEED TO CHECKOUT” at the bottom of the page.
  • From there, the payment sections will show, follow the guided payment process and your order will be available for our writing team to work on it.